>JMCP002A02 638 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAGAAGCCTCGTAGGCC
TTATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAAT
GCTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAG
AAGGATGAACAGGTATGGCTTGCTTGATGAGAGTCAGAACAAGCTTGATTATGTCCTTGC
CCTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCAAGGCTGGCAT
GGCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGGCAAAAGCACATCAGGGTTGGAAG
GCAGGTTGTGAACGTCCCCTCCTTCTTGGTCAGAGTGGACTCGCagaAGCACATTGATTT
CTCACTGTCCAGTCCTTTTGGTGGCGGTCGCCCTGGTAGGGTGAAGCGAAAGAACTAG