>JMCP001H08 470 bp,:Filtered
TCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAGGCTGGACC
ATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAA
AACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACA
AGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTttcactggttgcagctg
taaccacccccacttcaaactagcaggacaggacacgttctgtaaagtatttctgtaaga
tattgtttgtttgcaagcgtctcacagagagccacacAAAACaacaatactATgcaagtg
TATTCATTATTagaTTTCATCAATCTATTTCTCAATTTcgtCAACTCTGAAATACAGTTC
ATGCAAT