>JMCP001D06 618 bp,
AGGGATTTATAGGCCTTCATGaGAAATAATTTAAAGTGCATTTATTAACGGATTTTTTTT
TTGAAAAATAAAAATTGAATAAAGTTAACATTTACTTGTTCTTTTGGAAAATCAAAATAA
ATACTGGagaATTAAAATTTAAAAAAAAAAACTAAAAATagacgacacCAACAACAACAA
CAAcgataataataataataataATTGATGTAAACAAAGTCAAAACCCATTTCCttgtgG
GCAgtgagCacagatcTAaCcTcTgtgGTTCatgTTCAGTTGaGtTACCAtgATTTACat
CctctcAAaTGCTTTGTCggaTCGGGTTGGGGTTCagtCTTTTggaaaaataATTGATGT
AAACAAAGTCAAAACCCATTTCTagaCatGTTCTATCTGGCTTTTcgaTCCCATTTTAGG
TctcTGCTagccacgctgaAaATCctcTtTagctCACATTCAACAATTTTTACccagaat
agagtaATCCATCttaAAACTCTAagcCCTAAACCCTATTatAATTTTTTAtaCCCAAAA
TTCATTACAAATTACATGTTTAAAAG