>JMCP001B09 628 bp,:PolyA
GTGTCCTGGCAGGGGAAAATGGACCTGGCGTGGATGGACTGACATTGGGTGTAAACAAAC
GGGTGGGTTTTGTTAAAAGTTTGCGGCGGCGAAAGCCACTGGAGAGCTGAGCTAGAGGGG
CTCGTTTTCGaGAGCACCAACACCTGAGCTTGGCCCGAAAGTGAGACGGTGACTGATTGC
CCGATCACTGGGTCCGGCAGGGACGGagaAAGGGAgaAGGGGAGCGGCGAAAGTGAAACT
GGGTCGAGAACGGCggagatgGAGAGGGAACGGGTGTCAAGAGTGAGGTCGCCGGAATAA
GGGGCGGCGAGGGagaGGAGAGTCGCagcagaGATAGTTGAGGACGGGAAATCAAAGTAG
AGAGTAAGGGAGATATGGACAGTGAAGGGATGAGCAGAGTCCGTGAAAGAATGGGGATCA
ACGGGCGCCATGACTTCGGTTTTGCAAGGACTTCTACACAAAACTGGATTTTTGGAGTag
cgaagaagacgATTGCTTTTTTCTAAAATTTACCGTCTTGGAGGGTCAAGACCGCagaTG
CATAAATATATGAGaTTTGAgaATAATTGACACTTCCGC