>JMCP001B06 643 bp,
CGATCTCTCTCCCCCCCTTAAATCTCCTCTCGTcTCCTCAAACCCAACCCAAATCCGACT
CGCTTCCTATATCTCTCTCTCTCTCCGTTTCTTCAACCTCAGCTCTCTCTCTCTAGAATT
GTTCATAcagAaatCGTTTGTTTTTTTCTTTTGAGAAATTTTTGTTGTTGTGAAAATGGT
ACAGAAGACGGAGAAGGAGGAGACGGAGTTCaaggTGGTACCTGAGACCATAACGCCGTG
CGTCAACGActgCGgcgTGACCGGGAACCCGGCCACCAACAGCATGTGTCAGAAGTGCTT
CAACGCCACCACGGCTGCGTCTACCTCCAgCTCCGTCGCGGCGTCAACAgTGCCGATTCC
GCaCAAGTTCGCCGAGAAGTCGCCTAGATCTACCTTCCGGAGGACTTCTCCCGGGAGAAC
GGTTCCAGATCTGAAGAAGCTGGAAGATTCGACGGACAAAATCGACGAGAAAACCGGAGA
GAGCTCGCCGGCTCCTGCGAAGAGAGAGGTGAACCGTTGCTCCGGCTGCCGGAGGAAGGT
CGGCTTGACCGGATTCCGTTGCCGGTGCGGCGAGCTCTTCTGCGGAGAGCACCGGTA