>JMCP001B02 395 bp,:Filtered
CTTACATCGGGGGAGTTTCGTGCCcaTACATATGCTCCAAGAGGCTGGACCATGGTGTCC
TGTTGGTGGGTTATGGTtcagcAGGCTacgcTcCCATCCGGTTGAAAGAAAAACCATATT
GGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACAAGATCTGCC
GGGGTCGCAATATCTGTGGAGTGGGCTCCATGGTTTCTACTGTTGCAGCTGTTAACACCC
CCACTTCagaCTAGCAGGACAGGACACGTTCTGTAAAGTaGTTCTGTAagaTATTGTTTG
TTTGCAAGCGTCTCACAGAGAGCCACACAAAACGACATACTATGCAAGTGTATTCATTAT
TAGATTTCATCAATCTATTTCTCAATTTCGTCAAG